shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Csn1s1-shRNA-Seq1)(CAT#: AdV-SI2296WQ)
This product is a Csn1s1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Csn1s1 gene may play an important role in the capacity of milk to transport calcium phosphate. The expression of Csn1s1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Csn1s1-shRNA-Seq1 |
| Related Target/Protein | Csn1s1 |
| Region | CDS |
| TargetSeq | CCCACAAATCTTCCAGTATGA |
| NCBI RefSeq | NM_007784 |
| Alternative Names | CASA; CSN1 |
| Titer | >1*10^10 GC/mL |
