shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(DOLK-shRNA-Seq1)(CAT#: AdV-SI0466WQ)
This product is a DOLK-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by DOLK gene catalyzes the CTP-mediated phosphorylation of dolichol, and is involved in the synthesis of Dol-P-Man. The expression of DOLK-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | DOLK-shRNA-Seq1 |
| Related Target/Protein | DOLK |
| Region | CDS |
| TargetSeq | GCCTTTGCTTGGACTAGTCAT |
| NCBI RefSeq | NM_014908 |
| Alternative Names | DK; DK1; CDG1M; SEC59; TMEM15 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Dolichol kinase deficiency |