shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Fbxw16-shRNA-Seq3)(CAT#: AdV-SI1838WQ)

This product is a Fbxw16-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of Fbxw16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Fbxw16-shRNA-Seq3
Related Target/Protein Fbxw16
Region CDS
TargetSeq CCAGAACAGATCTTTAGACTA
NCBI RefSeq NM_177070
Alternative Names 7420402K12Rik
Titer >1*10^10 GC/mL
Target Gene
Gene ID 320083
Uniprot ID Q497Z0

Related Products