shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Fchsd1-shRNA-Seq1)(CAT#: AdV-SI1883WQ)

This product is a Fchsd1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Fchsd1 gene may promotes actin polymerization mediated by SNX9 and WASL. The expression of Fchsd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert Fchsd1-shRNA-Seq1
Related Target/Protein Fchsd1
Region CDS
TargetSeq GAAGGCAACGTCTCAGGTAAA
NCBI RefSeq NM_175684
Alternative Names NWK2
Titer >1*10^10 GC/mL
Target Gene
Gene ID 89848
Uniprot ID Q86WN1

Related Products