shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(MAP6D1-shRNA-Seq3)(CAT#: AdV-SI0199WQ)
This product is a MAP6D1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | MAP6D1-shRNA-Seq3 |
| Related Target/Protein | MAP6D1 |
| Region | 3UTR |
| TargetSeq | GCTGAGTATCCAGGAGGAAAT |
| NCBI RefSeq | NM_024871 |
| Alternative Names | SL21; MAPO6D1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Renal cancer |
