shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(GLOD4-shRNA-Seq2)(CAT#: AdV-SI0143WQ)
This product is a GLOD4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. Transfection of GLOD4 gene in hepatocellular carcinoma cells and overexpression can inhibit the cell growth. The expression of GLOD4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | GLOD4-shRNA-Seq2 |
| Related Target/Protein | GLOD4 |
| Region | 3UTR |
| TargetSeq | CGAGCTTCTTTCTGTGTATAT |
| NCBI RefSeq | NM_016080 |
| Alternative Names | HC71; CGI-150; C17orf25 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Hepatocellular carcinoma |
