shRNA Adenovirus Serotype 5 (ΔE1/E3), pH1-(RBM33-shRNA-Seq2)(CAT#: AdV-SI2956WQ)

This product is a RBM33-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The expression of RBM33-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert RBM33-shRNA-Seq2
Related Target/Protein RBM33
Region CDS
TargetSeq CAGAGTTTACAGATGCTTCCT
NCBI RefSeq NM_001008408
Alternative Names PRR8
Titer >1*10^10 GC/mL
Target Gene
Gene ID 155435
Uniprot ID Q96EV2

Related Products