shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Ints10-shRNA-Seq1)(CAT#: AdV-SI2344WQ)
This product is a Ints10-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. Ints10 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit and mediates 3-prime end processing of small nuclear RNAs U1 and U2. The expression of Ints10-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Ints10-shRNA-Seq1 |
| Related Target/Protein | Ints10 |
| Region | CDS |
| TargetSeq | GCCGACTTCAACATCCAGTAT |
| NCBI RefSeq | NM_027590 |
| Alternative Names | INT10; C8orf35 |
| Titer | >1*10^10 GC/mL |
