shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(LGI4-shRNA-Seq2)(CAT#: AdV-SI0092WQ)
This product is a LGI4-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The LGI4 gene encoded protein is component of Schwann cell signaling pathway(s) that controls axon segregation and myelin formation (By similarity). The expression of LGI4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | LGI4-shRNA-Seq2 |
| Related Target/Protein | LGI4 |
| Region | CDS |
| TargetSeq | GATCTACCAGCATCACGAGAT |
| NCBI RefSeq | NM_139284 |
| Alternative Names | LGIL3; AMCNMY |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Neurological diseases |