shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(MAP6D1-shRNA-Seq2)(CAT#: AdV-SI0198WQ)

This product is a MAP6D1-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The MAP6D1 gene encodes a protein highly similar to the mouse MAP6 domain containing 1 protein, which is related to the STOP proteins. The expression of MAP6D1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert MAP6D1-shRNA-Seq2
Related Target/Protein MAP6D1
Region CDS
TargetSeq CCTCAAGATCCACAAAGACAA
NCBI RefSeq NM_024871
Alternative Names SL21; MAPO6D1
Titer >1*10^10 GC/mL
Related Diseases Renal cancer
Target Gene
Gene ID 79929
Uniprot ID Q9H9H5

Related Products