shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(NLRP9-shRNA-Seq2)(CAT#: AdV-SI1516WQ)

This product is a NLRP9-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by NLRP9 gene belongs to the NALP protein family. This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. The expression of NLRP9-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert NLRP9-shRNA-Seq2
Related Target/Protein NLRP9
Region 3UTR
TargetSeq CGTCTCACAAAGGCTTTCCTT
NCBI RefSeq NM_176820
Alternative Names NOD6; NALP9; PAN12; CLR19.1
Titer >1*10^10 GC/mL
Related Diseases Immune system disease
Target Gene
Gene ID 338321
Uniprot ID Q7RTR0

Related Products