shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(OR5B12-shRNA-Seq4)(CAT#: AdV-SI1652WQ)
This product is a OR5B12-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The OR5B12 gene encodes a olfactory receptor protein that interacts with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The expression of OR5B12-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | OR5B12-shRNA-Seq4 |
| Related Target/Protein | OR5B12 |
| Region | CDS |
| TargetSeq | CCACTCTTCATAGTCTTCCTT |
| NCBI RefSeq | XM_372409 |
| Alternative Names | OR5B16; OST743; OR5B12P; OR11-241 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Olfactory dysfunction |