shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Peo1-shRNA-Seq2)(CAT#: AdV-SI1841WQ)
This product is a Peo1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The gene Peo1 encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The expression of Peo1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Peo1-shRNA-Seq2 |
| Related Target/Protein | Peo1 |
| Region | CDS |
| TargetSeq | GGTGTCTATCACAACCTATTT |
| NCBI RefSeq | NM_153796 |
| Alternative Names | PEO; TWNK; SCA8; ATXN8; IOSCA; PEOA3; SANDO; TWINL; MTDPS7; PRLTS5; C10orf2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Infantile onset spinocerebellar ataxia (IOSCA), Progressive external ophthalmoplegia (PEO), Several mitochondrial depletion syndromes |