shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Poc5-shRNA-Seq4)(CAT#: AdV-SI1892WQ)
This product is a Poc5-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Poc5 gene is essential for the assembly of the distal half of centrioles, required for centriole elongation. The expression of Poc5-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Poc5-shRNA-Seq4 |
| Related Target/Protein | Poc5 |
| Region | CDS |
| TargetSeq | CCATCTCACCTTAGAGGAGAA |
| NCBI RefSeq | NM_026173 |
| Alternative Names | C5orf37 |
| Titer | >1*10^10 GC/mL |