shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Pomp-shRNA-Seq3)(CAT#: AdV-SI1727WQ)
This product is a Pomp-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by Pomp gene is a molecular chaperone that binds 20S preproteasome components and is essential for 20S proteasome formation. The expression of Pomp-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Pomp-shRNA-Seq3 |
| Related Target/Protein | Pomp |
| Region | 3UTR |
| TargetSeq | GCAGTAAAGTACAGAGAGGAT |
| NCBI RefSeq | NM_025624 |
| Alternative Names | UMP1; PRAAS2; HSPC014; C13orf12; PNAS-110 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | KLICK syndrome |