shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SDK2-shRNA-Seq1)(CAT#: AdV-SI0391WQ)
This product is a SDK2-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The protein encoded by SDK2 gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. The expression of SDK2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | HAdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Insert | SDK2-shRNA-Seq1 |
| Related Target/Protein | SDK2 |
| Region | CDS |
| TargetSeq | GATCCGCTACATTCTGGAGAT |
| NCBI RefSeq | NM_019064 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Retina desease |