shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SESN1-shRNA-Seq1)(CAT#: AdV-SI1759WQ)

This product is a SESN1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The protein encoded by SESN1 gene is a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The expression of SESN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert SESN1-shRNA-Seq1
Related Target/Protein SESN1
Region 3UTR
TargetSeq GCAAAGAATGGGACTTGGATA
NCBI RefSeq NM_014454
Alternative Names PA26; SEST1
Titer >1*10^10 GC/mL
Related Diseases DNA damage
Target Gene
Gene ID 27244
Uniprot ID Q9Y6P5

Related Products