shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(SPAM1-shRNA-Seq2)(CAT#: AdV-SI1507WQ)

This product is a SPAM1-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The SPAM1 gene encodes a GPI-anchored enzyme located on the human sperm surface and inner acrosomal membrane. This multifunctional protein is a hyaluronidase that enables sperm to penetrate through the hyaluronic acid-rich cumulus cell layer surrounding the oocyte, a receptor that plays a role in hyaluronic acid induced cell signaling, and a receptor that is involved in sperm-zona pellucida adhesion. The expression of SPAM1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert SPAM1-shRNA-Seq2
Related Target/Protein SPAM1
Region CDS
TargetSeq GCAAGGAGTGTGTATAAGGAA
NCBI RefSeq NM_003117
Alternative Names HYA1; PH20; HYAL1; HYAL3; HYAL5; PH-20; SPAG15; HEL-S-96n
Titer >1*10^10 GC/mL
Related Diseases Infertility
Target Gene
Gene ID 6677
Uniprot ID P38567

Related Products