shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(Tmem231-shRNA-Seq3)(CAT#: AdV-SI1824WQ)
This product is a Tmem231-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The Tmem231 gene encodes a transmembrane protein, which is a component of the B9 complex involved in the formation of the diffusion barrier between the cilia and plasma membrane. Mutations in this gene cause Joubert syndrome (JBTS). The expression of Tmem231-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | Tmem231-shRNA-Seq3 |
| Related Target/Protein | Tmem231 |
| Region | CDS |
| TargetSeq | GCTAATCCTGACCTTCTCCTA |
| NCBI RefSeq | NM_001033321 |
| Alternative Names | MKS11; JBTS20; ALYE870; PRO1886 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Joubert syndrome |