shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(TRABD-shRNA-Seq2)(CAT#: AdV-SI0249WQ)

This product is a TRABD-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The TRABD encodes metalloprotease that acts as a negative regulator of the Wnt signaling pathway by mediating the cleavage of the 8 N-terminal residues of a subset of Wnt proteins. The expression of TRABD-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype HAdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Insert TRABD-shRNA-Seq2
Related Target/Protein TRABD
Region 3UTR
TargetSeq CCACCCAAATAAAGGATTATT
NCBI RefSeq NM_025204
Alternative Names LP6054; PP2447
Titer >1*10^10 GC/mL
Related Diseases Graves' Disease
Target Gene
Gene ID 80305
Uniprot ID Q9H4I3

Related Products