shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(XKR6-shRNA-Seq4)(CAT#: AdV-SI1999WQ)
This product is a XKR6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Adenoviridae |
| Species | Adenovirus |
| Serotype | AdV-5 |
| Backbone | AdV-5 (ΔE1/E3) |
| Tropism | Both nondividing and dividing cells |
| Modification | ΔE1/E3 |
| Insert | XKR6-shRNA-Seq4 |
| Related Target/Protein | XKR6 |
| Region | CDS |
| TargetSeq | GATCGCAATGATGCTCTTATA |
| NCBI RefSeq | NM_173683 |
| Alternative Names | XRG6; C8orf5; C8orf7; C8orf21 |
| Titer | >1*10^10 GC/mL |