shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(XKR6-shRNA-Seq4)(CAT#: AdV-SI1999WQ)

This product is a XKR6-shRNA encoding AdV, which is based on AdV-5 serotype with E1/E3 gene deleted. The XKR6 gene may play an important role in cell apoptotic process. The expression of XKR6-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Adenoviridae
Species Adenovirus
Serotype AdV-5
Backbone AdV-5 (ΔE1/E3)
Tropism Both nondividing and dividing cells
Modification ΔE1/E3
Insert XKR6-shRNA-Seq4
Related Target/Protein XKR6
Region CDS
TargetSeq GATCGCAATGATGCTCTTATA
NCBI RefSeq NM_173683
Alternative Names XRG6; C8orf5; C8orf7; C8orf21
Titer >1*10^10 GC/mL
Target Gene
Gene ID 286046
Uniprot ID Q5GH73

Related Products