shRNA Adenovirus Serotype 5 (ΔE1/E3), pU6-(ZNF280C-shRNA-Seq1)(CAT#: AdV-SI0443WQ)
This product is a ZNF280C-shRNA encoding AdV, which is based on AdV-5 serotype with EIB-55K gene deleted. The ZNF280C gene encodes a member of the zinc finger domain-containing protein family. The expression of ZNF280C-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Adenoviridae |
Species | Adenovirus |
Serotype | HAdV-5 |
Backbone | AdV-5 (ΔE1/E3) |
Tropism | Both nondividing and dividing cells |
Insert | ZNF280C-shRNA-Seq1 |
Related Target/Protein | ZNF280C |
Region | CDS |
TargetSeq | CCTCAGATAAATCCCTCCACT |
NCBI RefSeq | NM_017666 |
Alternative Names | ZPET; SUHW3; ZNF633 |
Titer | >1*10^10 GC/mL |