shRNA Lentivirus (self-inactivating), p7SK-(CIAPIN1-shRNA-Seq2)(CAT#: LV-SI1277WQ)
This product is a CIAPIN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 or CASP families. The expression of CIAPIN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | CIAPIN1-shRNA-Seq2 |
Related Target/Protein | CIAPIN1 |
Region | 3UTR |
TargetSeq | GCAGAACTCTGAACGACAATA |
NCBI RefSeq | NM_020313 |
Alternative Names | DRE2; CIAE2; PRO0915; Anamorsin |
Titer | >1*10^10 GC/mL |
Related Diseases | Hepatocellular Carcinoma |