shRNA Lentivirus (self-inactivating), p7SK-(Gaa-shRNA-Seq1)(CAT#: LV-SI3937WQ)
This product is a Gaa-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Gaa gene encodes lysosomal alpha-glucosidase, which is essential for the degradation of glycogen to glucose in lysosomes. The expression of Gaa-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gaa-shRNA-Seq1 |
| Related Target/Protein | Gaa |
| Region | 3UTR |
| TargetSeq | CCCTGAAGCTCTGTGTTCTTA |
| NCBI RefSeq | NM_008064 |
| Alternative Names | LYAG |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Pompe's disease |