shRNA Lentivirus (self-inactivating), p7SK-(GAGE4-shRNA-Seq1)(CAT#: LV-SI1449WQ)

This product is a GAGE4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The GAGE4 gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The expression of GAGE4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert GAGE4-shRNA-Seq1
Related Target/Protein GAGE4
Region CDS
TargetSeq CCTGAAATGATTGGGCCTATG
NCBI RefSeq NM_001474
Alternative Names CT4.4
Titer >1*10^10 GC/mL
Related Diseases Breast Cancer
Target Gene
Gene ID 2576
Uniprot ID B7ZVY3

Related Products