shRNA Lentivirus (self-inactivating), pU6-(JOSD2-shRNA-Seq2)(CAT#: LV-SI0372WQ)
This product is a JOSD2-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The JOSD2 gene encodes a protein containing a Josephin domain. Josephin domain-containing proteins are deubiquitinating enzymes which catalyze the hydrolysis of the bond between the C-terminal glycine of the ubiquitin peptide and protein substrates. The expression of JOSD2-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | JOSD2-shRNA-Seq2 |
| Related Target/Protein | JOSD2 |
| Region | CDS |
| TargetSeq | GTGTCTACTACAACCTGGACT |
| NCBI RefSeq | NM_138334 |
| Alternative Names | SBBI54 |
| Titer | >1*10^10 GC/mL |