shRNA Lentivirus (self-inactivating), p7SK-(Gsdmd-shRNA-Seq1)(CAT#: LV-SI4016WQ)
This product is a Gsdmd-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Gsdmd-shRNA-Seq1 |
| Related Target/Protein | Gsdmd |
| Region | CDS |
| TargetSeq | CTGGTGAACATCGGAAAGATT |
| NCBI RefSeq | NM_026960 |
| Alternative Names | DF5L; DFNA5L; FKSG10; GSDMDC1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Cancer |
