shRNA Lentivirus (self-inactivating), p7SK-(Gsdmd-shRNA-Seq1)(CAT#: LV-SI4016WQ)
This product is a Gsdmd-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Gsdmd gene is a member of the gasdermin family and play a role in regulation of epithelial proliferation. The expression of Gsdmd-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Gsdmd-shRNA-Seq1 |
Related Target/Protein | Gsdmd |
Region | CDS |
TargetSeq | CTGGTGAACATCGGAAAGATT |
NCBI RefSeq | NM_026960 |
Alternative Names | DF5L; DFNA5L; FKSG10; GSDMDC1 |
Titer | >1*10^10 GC/mL |
Related Diseases | Cancer |