shRNA Lentivirus (self-inactivating), p7SK-(KHDRBS1-shRNA-Seq2)(CAT#: LV-SI1047WQ)
This product is a KHDRBS1-shRNA encoding Lentivirus, which is based on HIV-1 serotype.The KHDRBS1 encoded protein appears to have many functions and may be involved in a variety of cellular processes, including alternative splicing, cell cycle regulation, RNA 3'-end formation, tumorigenesis, and regulation of human immunodeficiency virus gene expression. The expression of KHDRBS1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | KHDRBS1-shRNA-Seq2 |
Related Target/Protein | KHDRBS1 |
Region | CDS |
TargetSeq | GTACCGGATATGATGGATGAT |
NCBI RefSeq | NM_006559 |
Alternative Names | p62; p68; Sam68 |
Titer | >1*10^10 GC/mL |
Related Diseases | Primary ovarian insufficiency |