shRNA Lentivirus (self-inactivating), p7SK-(RTBDN-shRNA-Seq1)(CAT#: LV-SI1375WQ)
This product is a RTBDN-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by RTBDN gene is preferentially expressed in the retina and may play a role in binding retinoids and other carotenoids as it shares homology with riboflavin binding proteins. The expression of RTBDN-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | RTBDN-shRNA-Seq1 |
| Related Target/Protein | RTBDN |
| Region | CDS |
| TargetSeq | CCTTACCTATGGACAGACCTT |
| NCBI RefSeq | NM_031429 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Eye disease |