shRNA Lentivirus (self-inactivating), p7SK-(TMEM177-shRNA-Seq3)(CAT#: LV-SI3506WQ)
This product is a TMEM177-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | TMEM177-shRNA-Seq3 |
Related Target/Protein | TMEM177 |
Region | 3UTR |
TargetSeq | GCTATGAATCTGAGCCTTTGT |
NCBI RefSeq | NM_030577 |
Titer | >1*10^10 GC/mL |