shRNA Lentivirus (self-inactivating), p7SK-(ZNF827-shRNA-Seq2)(CAT#: LV-SI3987WQ)

This product is a ZNF827-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The ZNF827 gene encodes a protein that may be involved in transcriptional regulation. The expression of ZNF827-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert ZNF827-shRNA-Seq2
Related Target/Protein ZNF827
Region CDS
TargetSeq GAAGAATATCAGCTCCAGAAA
NCBI RefSeq NM_178835
Titer >1*10^10 GC/mL
Target Gene
Gene ID 152485
Uniprot ID Q17R98

Related Products