shRNA Lentivirus (self-inactivating), p7SK-(FAM124A-shRNA-Seq1)(CAT#: LV-SI1287WQ)

Datasheet

This product is a FAM124A-shRNA encoding Lentivirus, which is based on HIV-1 serotype. FAM124A belongs to the FAM124 family. The expression of FAM124A-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert FAM124A-shRNA-Seq1
Related Target/Protein FAM124A
Region CDS
TargetSeq GTGCATAAGAAGTTTCCTAAA
NCBI RefSeq NM_145019
Titer >1*10^10 GC/mL
Related Diseases Mycoplasma pneumoniae pneumonia
Target Gene
Gene ID 220108
Uniprot ID Q86V42

Related Products

Recombinant lentivirus, pU6-(Rattus jph2), Overexpression (CAT#:Lenti-GTOH0740WQ) shRNA Lentivirus (self-inactivating), pH1-(PRRC2A-shRNA-Seq2) (CAT#:LV-SI0895WQ) Recombinant lentivirus, pU6-(Human APP), Overexpression (CAT#:Lenti-GTOH0315WQ) shRNA Lentivirus (self-inactivating), pU6-(MFSD6L-shRNA-Seq1) (CAT#:LV-SI2091WQ) shRNA Lentivirus (self-inactivating), pU6-(OR2A5-shRNA-Seq2) (CAT#:LV-SI1556WQ) Recombinant lentivirus, pU6-(Human TUSC3 3'UTR), Overexpression (CAT#:Lenti-GTOH0028WQ) shRNA Lentivirus (self-inactivating), pU6-(Eif2b1-shRNA-Seq4) (CAT#:LV-SI1914WQ) shRNA Lentivirus (self-inactivating), pH1-(Rufy2-shRNA-Seq2) (CAT#:LV-SI2794WQ)