shRNA Lentivirus (self-inactivating), pH1-(AARSD1-shRNA-Seq3)(CAT#: LV-SI0846WQ)
This product is a AARSD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The AARSD1 gene functions in trans to edit the amino acid moiety from incorrectly charged tRNA(Ala). The expression of AARSD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | AARSD1-shRNA-Seq3 |
| Related Target/Protein | AARSD1 |
| Region | CDS |
| TargetSeq | CCTGATATTTCTGTCTGGGAA |
| NCBI RefSeq | NM_025267 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Breast cancer |