shRNA Lentivirus (self-inactivating), pH1-(Btla-shRNA-Seq1)(CAT#: LV-SI2578WQ)
This product is a Btla-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Btla gene is a member of the immunoglobulin superfamily and relays inhibitory signals to suppress the immune response. The expression of Btla-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Btla-shRNA-Seq1 |
| Related Target/Protein | Btla |
| Region | CDS |
| TargetSeq | CTTCAGAACACCCACTAATAA |
| NCBI RefSeq | NM_177584 |
| Alternative Names | BTLA1; CD272 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Rheumatoid arthritis. |