shRNA Lentivirus (self-inactivating), pH1-(CLMP-shRNA-Seq1)(CAT#: LV-SI0598WQ)
This product is a CLMP-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CLMP gene encodes a type I transmembrane protein that is localized to junctional complexes between endothelial and epithelial cells and may have a role in cell-cell adhesion. The expression of CLMP-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | CLMP-shRNA-Seq1 |
| Related Target/Protein | CLMP |
| Region | CDS |
| TargetSeq | GAAGAAGAGAGACCTAATGAA |
| NCBI RefSeq | NM_024769 |
| Alternative Names | ACAM; ASAM; CSBM; CSBS |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Congenital short bowel syndrome |