shRNA Lentivirus (self-inactivating), pH1-(Erc1-shRNA-Seq1)(CAT#: LV-SI3186WQ)
This product is a Erc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Erc1 gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. The expression of Erc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Erc1-shRNA-Seq1 |
| Related Target/Protein | Erc1 |
| Region | CDS |
| TargetSeq | GCAGATAAAGAACGGACGATT |
| NCBI RefSeq | NM_053204 |
| Alternative Names | ELKS; Cast2; ERC-1; RAB6IP2 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Thyroid papillary carcinoma |
