shRNA Lentivirus (self-inactivating), pH1-(Hspa4-shRNA-Seq3)(CAT#: LV-SI2792WQ)
This product is a Hspa4-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of Hspa4-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Hspa4-shRNA-Seq3 |
| Related Target/Protein | Hspa4 |
| Region | CDS |
| TargetSeq | GACAAGTATTTGCAGTCCTAT |
| NCBI RefSeq | NM_008300 |
| Alternative Names | RY; APG-2; HSPH2; hsp70; hsp70RY; HEL-S-5a; HS24/P52 |
| Titer | >1*10^10 GC/mL |