shRNA Lentivirus (self-inactivating), pH1-(MRPL16-shRNA-Seq3)(CAT#: LV-SI0718WQ)

This product is a MRPL16-shRNA encoding Lentivirus, which is based on HIV-1 serotype. Among different species, the MRPL16 encoded proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. The expression of MRPL16-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert MRPL16-shRNA-Seq3
Related Target/Protein MRPL16
Region 3UTR
TargetSeq GAAGGATTCTGCATTTCTATT
NCBI RefSeq NM_017840
Alternative Names L16mt; MRP-L16; PNAS-111
Titer >1*10^10 GC/mL
Related Diseases Colorectal cancers
Target Gene
Gene ID 54948
Uniprot ID Q9NX20

Related Products