shRNA Lentivirus (self-inactivating), pH1-(Nudcd1-shRNA-Seq1)(CAT#: LV-SI2699WQ)
This product is a Nudcd1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Nudcd1 gene may be a suitable target for antigen-specific immunotherapy. The expression of Nudcd1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Nudcd1-shRNA-Seq1 |
| Related Target/Protein | Nudcd1 |
| Region | CDS |
| TargetSeq | GGCAGCACATGGACAATTAAA |
| NCBI RefSeq | NM_026149 |
| Alternative Names | CML66; OVA66 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | Solid tumors |
