shRNA Lentivirus (self-inactivating), pH1-(Pppde1-shRNA-Seq5)(CAT#: LV-SI2825WQ)
This product is a Pppde1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Pppde1 gene has deubiquitinating activity. The expression of Pppde1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | Pppde1-shRNA-Seq5 |
| Related Target/Protein | Pppde1 |
| Region | 3UTR |
| TargetSeq | CCCTCTTTATAGGGAAAGTAA |
| NCBI RefSeq | NM_024282 |
| Alternative Names | DESI; DESI1; DeSI-2; PNAS-4; PPPDE1; CGI-146; FAM152A; C1orf121; DESI2 |
| Titer | >1*10^10 GC/mL |