shRNA Lentivirus (self-inactivating), pH1-(Prb1-shRNA-Seq1)(CAT#: LV-SI3164WQ)
This product is a Prb1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The Prb1 gene encodes a member of the heterogeneous family of basic, proline-rich, human salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature peptides before secretion from the parotid glands. The expression of Prb1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Prb1-shRNA-Seq1 |
Related Target/Protein | Prb1 |
Region | CDS |
TargetSeq | CGAAGACTCAAATTCTCAGCT |
NCBI RefSeq | NM_198669 |
Alternative Names | PM; PMF; PMS; PRB1L; PRB1M |
Titer | >1*10^10 GC/mL |