shRNA Lentivirus (self-inactivating), pH1-(PRPF18-shRNA-Seq1)(CAT#: LV-SI0522WQ)
This product is a PRPF18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PRPF18 gene is found to be essential for the catalytic step II in pre-mRNA splicing process. Mutations in this gene result in RNA synthesis dysfunction.The expression of PRPF18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | PRPF18-shRNA-Seq1 |
| Related Target/Protein | PRPF18 |
| Region | 3UTR |
| TargetSeq | GATCTGTGTATGGTGTGTTAA |
| NCBI RefSeq | NM_003675 |
| Alternative Names | PRP18; hPrp18 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | late-onset Alzheimer disease (LOAD) |