shRNA Lentivirus (self-inactivating), pH1-(PRPF18-shRNA-Seq1)(CAT#: LV-SI0522WQ)

This product is a PRPF18-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by PRPF18 gene is found to be essential for the catalytic step II in pre-mRNA splicing process. Mutations in this gene result in RNA synthesis dysfunction.The expression of PRPF18-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert PRPF18-shRNA-Seq1
Related Target/Protein PRPF18
Region 3UTR
TargetSeq GATCTGTGTATGGTGTGTTAA
NCBI RefSeq NM_003675
Alternative Names PRP18; hPrp18
Titer >1*10^10 GC/mL
Related Diseases late-onset Alzheimer disease (LOAD)
Target Gene
Gene ID 8559
Uniprot ID Q99633

Related Products