shRNA Lentivirus (self-inactivating), pH1-(SESN1-shRNA-Seq1)(CAT#: LV-SI2609WQ)
This product is a SESN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SESN1 gene is a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The expression of SESN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | SESN1-shRNA-Seq1 |
| Related Target/Protein | SESN1 |
| Region | 3UTR |
| TargetSeq | GCAAAGAATGGGACTTGGATA |
| NCBI RefSeq | NM_014454 |
| Alternative Names | PA26; SEST1 |
| Titer | >1*10^10 GC/mL |
| Related Diseases | DNA damage |
