shRNA Lentivirus (self-inactivating), pH1-(SESN1-shRNA-Seq1)(CAT#: LV-SI2609WQ)
This product is a SESN1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by SESN1 gene is a member of the sestrin family. Sestrins are induced by the p53 tumor suppressor protein and play a role in the cellular response to DNA damage and oxidative stress. The expression of SESN1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | SESN1-shRNA-Seq1 |
Related Target/Protein | SESN1 |
Region | 3UTR |
TargetSeq | GCAAAGAATGGGACTTGGATA |
NCBI RefSeq | NM_014454 |
Alternative Names | PA26; SEST1 |
Titer | >1*10^10 GC/mL |
Related Diseases | DNA damage |