shRNA Lentivirus (self-inactivating), pH1-(SESTD1-shRNA-Seq1)(CAT#: LV-SI0784WQ)

This product is a SESTD1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The SESTD1 gene may act as the primary docking protein directing membrane turnover and assembly of the transient receptor potential channels TRPC4 and TRPC5. The expression of SESTD1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert SESTD1-shRNA-Seq1
Related Target/Protein SESTD1
Region CDS
TargetSeq GATTAACTGTTCCAGTAGTTT
NCBI RefSeq NM_178123
Alternative Names SOLO
Titer >1*10^10 GC/mL
Related Diseases Lithium-responsive bipolar disorder
Target Gene
Gene ID 91404
Uniprot ID Q86VW0

Related Products