shRNA Lentivirus (self-inactivating), pH1-(TMEM177-shRNA-Seq5)(CAT#: LV-SI2658WQ)
This product is a TMEM177-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The preotien encoded by TMEM177 gene plays a role in the early steps of cytochrome c oxidase subunit II (MT-CO2/COX2) maturation. The expression of TMEM177-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
| Specifications | |
|---|---|
| Family | Retroviridae |
| Species | Lentivirus |
| Serotype | HIV-1 |
| Backbone | Lenti-SIN |
| Tropism | Both nondividing and dividing cells |
| Insert | TMEM177-shRNA-Seq5 |
| Related Target/Protein | TMEM177 |
| Region | 3UTR |
| TargetSeq | CCTATAGCTCAAGGCCAGAAA |
| NCBI RefSeq | NM_030577 |
| Titer | >1*10^10 GC/mL |