shRNA Lentivirus (self-inactivating), pU6-(ANKRD20A1-shRNA-Seq2)(CAT#: LV-SI0201WQ)
This product is a ANKRD20A1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of ANKRD20A1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | ANKRD20A1-shRNA-Seq2 |
Related Target/Protein | ANKRD20A1 |
Region | CDS |
TargetSeq | CAAGTTCACATGCCGTTGATA |
NCBI RefSeq | NM_032250 |
Alternative Names | ANKRD20A |
Titer | >1*10^10 GC/mL |
Related Diseases | Behçet's disease |