shRNA Lentivirus (self-inactivating), pU6-(C1orf126-shRNA-Seq3)(CAT#: LV-SI2094WQ)

This product is a C1orf126-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The expression of C1orf126-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert C1orf126-shRNA-Seq3
Related Target/Protein C1orf126
Region 3UTR
TargetSeq CGAACCATGTAAGTGCCATTT
NCBI RefSeq NM_182534
Alternative Names C1orf126
Titer >1*10^10 GC/mL
Target Gene
Gene ID 200197
Uniprot ID B3KW75

Related Products