shRNA Lentivirus (self-inactivating), pH1-(TEX13B-shRNA-Seq1)(CAT#: LV-SI0770WQ)

This product is a TEX13B-shRNA encoding Lentivirus, which is based on HIV-1 serotype. TEX13B is spermatogonially-expressed, germ-cell-specific genes. The expression of TEX13B-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert TEX13B-shRNA-Seq1
Related Target/Protein TEX13B
Region CDS
TargetSeq CAGGTCAGTACAAACAGCCAT
NCBI RefSeq NM_031273
Alternative Names TGC3B; TSGA5
Titer >1*10^10 GC/mL
Related Diseases Testis cancer
Target Gene
Gene ID 56156
Uniprot ID Q9BXU2

Related Products