shRNA Lentivirus (self-inactivating), pU6-(CAMSAP1-shRNA-Seq1)(CAT#: LV-SI0302WQ)

This product is a CAMSAP1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The CAMSAP1 encoded protein is a key microtubule-organizing protein that specifically binds the minus-end of non-centrosomal microtubules and regulates their dynamics and organization. The expression of CAMSAP1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.

Specifications
Family Retroviridae
Species Lentivirus
Serotype HIV-1
Backbone Lenti-SIN
Tropism Both nondividing and dividing cells
Insert CAMSAP1-shRNA-Seq1
Related Target/Protein CAMSAP1
Region CDS
TargetSeq GAAAGCAATCAGCGGACACTT
NCBI RefSeq NM_015447
Titer >1*10^10 GC/mL
Related Diseases Hepatocellular Carcinoma
Target Gene
Gene ID 157922
Uniprot ID Q5T5Y3

Related Products