shRNA Lentivirus (self-inactivating), pU6-(Erc1-shRNA-Seq1)(CAT#: LV-SI2336WQ)
This product is a Erc1-shRNA encoding Lentivirus, which is based on HIV-1 serotype. The protein encoded by Erc1 gene is a member of a family of RIM-binding proteins. RIMs are active zone proteins that regulate neurotransmitter release. The expression of Erc1-shRNA leads to target gene silencing and this product can be used in gene therapy research and development.
Specifications | |
---|---|
Family | Retroviridae |
Species | Lentivirus |
Serotype | HIV-1 |
Backbone | Lenti-SIN |
Tropism | Both nondividing and dividing cells |
Insert | Erc1-shRNA-Seq1 |
Related Target/Protein | Erc1 |
Region | CDS |
TargetSeq | GCAGATAAAGAACGGACGATT |
NCBI RefSeq | NM_053204 |
Alternative Names | ELKS; Cast2; ERC-1; RAB6IP2 |
Titer | >1*10^10 GC/mL |
Related Diseases | Thyroid papillary carcinoma |